CRISPOR
Design, evaluate and clone guide sequences for the CRISPR/Cas9 system
About US
TEFOR proposes integrated services in genome editing, transgenesis, 3D image acquisition and annotation focusing on the zebrafish and the fruitfly.
In this context TEFOR performs technological research and development and establishes programs for the communities working on these model animals.
TEFOR is aimed at supporting research on two non mammalian model species : zebrafish and fruitfly. Through it's network EFOR and its integration into Celphedia it also aims at making available progress for other model species where possible. TEFOR is a distributed infrastructure which was founded in 2012 following the award of a French "Grand Emprunt" grant. It is promoted by three founder research organisms (CNRS, INRA, INSERM) as well as the University of Auvergne. By providing readily accessible services and resources and promoting the use of models raising fewer ethical concerns, TEFOR is of major interest to support both public and private research.
Research & Development
experiments as precursors of services
Services
from sequence to fish and fly
Phenotyping
3D & 3D+t image based phenotyping
Genome editing
ACTGAATTCCAGCGCTGAATAAATTTTAGAGCAAGTACCAGGGTCTGTGTGACCAGGGAATAG
Databases, Analysis & Software
images and tools for image analysis
Members of the Tefor Infrastructure
AMAGEN
Transgenesis is an essential technique for studies in vivo. In a research and development process improving the transgenesis techniques in both species, TEFOR-AMAGEN will provide customized transgenic lines to European research teams.
TEFOR CORE FACILITY
As part of the TEFOR infrastructure, the Tefor Core Facility is dedicated to Research and Development of new techniques in the field of fluorescence microscopy.
Fly Facility
The fruitfly Drosophilia melanogaster is a model organism well suited for transgenesis and direct dsRNA microinjection.
TACGENE
TACGENE was created in 2011 to facilitate access of academic laboratories to genome editing techniques.
BIOEMERGENCES
BioEmergences proposes collaborative services for the reconstruction of multilevel dynamics from the in vivo observation of developing model organisms.
LPGP Rennes
Our Scientific goal is the study of the main physiological functions of fish : growth and reproduction and our main models are rainbow trout, zebrafish, medaka, goldfish.
VIM-INRA Jouy-EN-JOSAS
The team “fish infection and immunity” aims at characterizing the fish pathogens and their interactions with their hosts.
TRIP NANTES
The rat transgenesis core facility is an academical structure producing transgenic, knock-out and knock-in rats in France and in Europe.
NEURO-PSI ROUYER’S LAB
Our work focused on Drosophilia, one of the most powerful animal models for studying the cellular and molecular basis of sleep-wake rhythms.
IJPB ANDREY’S TEAM
Our group gathers multi-disciplinary expertise aiming at developing methods and algorithms for extracting, analysing, and modeling spatial data from biological images.
RESEARCH & DEVELOPMENT
In the process of building atlases and/or developing services for our users the members of the Tefor infrastructure continually develop new skills, protocols and procedures. Some of these 'threads' make it later-on into the list of products and services, while others will stay in internal use only, depending on demand and public interest. Topics of interest currently are:
Get in touch
NETWORKS
 |
 |
 |
 |