ZeBraInspector
A whole organism screening platform enabling volumetric analysis of zebrafish brain white matter
About US
TEFOR proposes integrated services in genome editing, transgenesis, 3D image acquisition and annotation focusing on the zebrafish and the fruitfly.
In this context TEFOR performs technological research and development and establishes programs for the communities working on these model animals.
TEFOR is aimed at supporting research on two non mammalian model species : zebrafish and fruitfly. Through it's network EFOR and its integration into Celphedia it also aims at making available progress for other model species where possible. TEFOR is a distributed infrastructure which was founded in 2012 following the award of a French "Grand Emprunt" grant. It is promoted by three founder research organisms (CNRS, INRA, INSERM) as well as the University of Auvergne. By providing readily accessible services and resources and promoting the use of models raising fewer ethical concerns, TEFOR is of major interest to support both public and private research.
Research & Development
experiments as precursors of services
Services
from sequence to fish and fly
Phenotyping
3D & 3D+t image based phenotyping
Genome editing
ACTGAATTCCAGCGCTGAATAAATTTTAGAGCAAGTACCAGGGTCTGTGTGACCAGGGAATAG
Databases, Analysis & Software
images and tools for image analysis
Members of the Tefor Infrastructure
TEFOR PARIS-SACLAY
As part of the TEFOR infrastructure, TEFOR Paris-Saclay is dedicated to Research and Development of new techniques in the field of fluorescence microscopy.
Fly Facility
The fruitfly Drosophilia melanogaster is a model organism well suited for transgenesis and direct dsRNA microinjection.
TACGENE
TACGENE was created in 2011 to facilitate access of academic laboratories to genome editing techniques.